Encoding RIP from Elaeis Guaneensis Jacq

Encoding RIP from Elaeis Guaneensis Jacq Detection and expression profiling of two novel transcripts encoding RIP from Elaeis guaneensis Jacq. in Ganoderma boninense interaction 1. Introduction Among several oil-producing plants, oil palm (Elaeis guineensis) is a tropical crop which is exclusively grown for oil production. Its high oil yield is extracted from oil palm’s thick fleshy mesocarp which is extremely rich in oil (80% of dry mass). Furthermore, oil palm has the highest oil production (oil per unit land) compared to other oil-producing plants. The extracted oil has been used widely for several applications including, food, cosmetics, and bio-fuel (Paterson 2007; Murphy 2009; Alizadeh et al. 2013). Among various diseases , the basal stem rot (BSR) is known to be the most serious disease in oil palm (Ho and Nawawi 1985). Furthermore, the BSR is caused by Ganoderma boninense which is considered specifically as a â€Å"white rot fungus†. The lignin is broken by the fungus leaving whitish cellulose exposed (Paterson 2007). The infection process is initiated when the oil palm roots are penetrated by fungal mycelia, which is spread out to the stem bole, after which the trunk eventually collapses (Rees et al. 2009). Malaysia and Indonesia have suffered the most severe losses from the BSR; furthermore, the diseases has been identified in Malaysia several decades ago (Ho and Nawawi 1985; Idris et al. 2004; Rees et al. 2007). Oil palms of different genetic origins have shown to have resistance to BSR. However, the genes involved in the resistance of oil palms against G. Boninense were unknown (Idris et al. 2004; Durand-Gasselin et al. 2005). Recently, few defence related genes were identified in oil palm. The major pathogen on oil palm in Malaysia has been identified as G. boninense Pat. Stem rots of oil palm caused by species of Ganoderma are a major threat to the sustainability of the oil palm production. In this study, we have isolated one cDNA encoding RIP’s EST, from oil palm. Its expression in oil palm root infected by G. boninese; was investigated to shed light on its potential involvement during early disease development. 2. Materials and methods 2.1 Sample preparation A total of 24 six-month-old oil palm seedlings (Elaeis guineensis Jacq., DxP, GH500 series) were purchased from Sime Darby Plantation Sdn. Bhd. (Banting Malaysia) and divided into two groups with 12 seedlings in each group, one of these groups were treated with Ganoderma boninense Pat. Strain PER71, while the remaining group served as controls. Seedlings treated with G.boninense were inoculated by sitting each seedling on rubber woodblock fully grown with G.boninense PER71 while the other group of seedlings were inoculated with fungal surface mulch as described by (Alizadeh et al., 2011). Three biological replicates of the seedlings were harvested from each treatment at 4, 8, 12 wpi, respectively. The leaves, roots and stem cell were frozen in liquid nitrogen and stored at -80 °C (Tan et al., 2013). 2.2 RNA extraction Total RNA was extracted from treated and untreated oil palm root tissues using a modified CTAB method briefly, 0.1 g tissue was ground in liquid nitrogen into a very find powder. The powder was immediately transferred into 1.5 ml extraction CTAB buffer [ 2% (w/v) cetyl trimethyl ammonium bromide, CTAB; 100mM Tris-HCl, pH 8.0; 2M NaCl; 25 mM ethylenediamineteraacetic acid, EDTA; pH 8.0; 2% (w/v) polyvinylpyrrolidone, PVP; and 2% (v/v) ÃŽ ²-mercaptoethanool]. Equal volume of chloroform/isoamylalcohol (24:1, v/v) was added into the tube and centrifuged at 12,857 g for 15 min at 4 °C. The upper layer was transferred into a new tube and equal volume of phenol/chloroform/isoamylalcohol (25:24:1, v/v/v) was added and centrifuged. This step was repeated until a clear supernatant was obtained. The supernatant was adjusted to a final concentration of 2M LiCl, and incubated at 4 °C for overnight, and then centrifuged. The RNA was dissolved in 5ml diethypyrocarbonate (DEPC) – treated water. An equal volume of chloroform/isoamylalcohol was added, mixed, and centrifuged at 12,857 for 30 min at 4 °C. Precipitation of RNA was performed by adding 0.1 vol of 3M sodium acetate (pH 5.2), 2 vol 100% ethanol and incubated at -80 °C for overnight. After centrifugation, the pellet was washed using 70% ethanol and dissolved in 20ul DEPC-treated water. The quality of RNA was examined by using a Nanodrop( BioRad) at 230, 260 and 280 nm. The RNA integrity was examined using 1.5% agarose gel electrophoresis. The RNA was treated with DNase I (Qiagen, USA) following the manufacturer’s instructions. Figure : Total RNA from various treated and untreated oil palm tissues. Lane A: Untreated control seedling. Lane B: Treated seedlings. 1) Leaf. 2) Basal stem. 3) Root 3. Semi-quantitative Reverse transcriptase (RT-) PCR 3.1 Isolation of cDNA Omniscript â„ ¢ Reverse Transcriptase kit (Qiagen Kit) was used for cDNA synthesis by the following kit manuscript. To obtain the sequence of cDNA from oil palm, gene specific primers were designed based on oil palm expressed sequence tag (EST) (Ho, 2010) and RIP’s type I alignments, using primer 3 version 0.4.0(frodo.wi.mit.edu). 3.2 Sequence analysis of cDNA Semi-quantitative Reverse transcriptase (RT-) PCR was performed on EST using PCR machine with Reverse transcriptase enzyme. Equal amounts of RNA (1ug) extracted from control and treated oil palm root samples were converted into cDNA by using the Omniscript two step Reverse Transcription Kit for cDNA Synthesis (Qiagen, USA) following the manufacturer’s instructions. The resulted sequences shown significant similarities to RIP (Naher et al., 2011). 3.3 Expression profiling Expression levels were calculated by Quantity One 1-D Analysis software 4.6.5 (Bio-Rad) according to the manufacturer’s instructions. PCR products were resolved on 1.5%(w/v) agarose gel (1xTAE) with a DNA mass standard marker (MassRuler TM DNA Ladder, Fermentas). The density of the DNA mass standard dilution series was used to generate calibration curve for absolute quantisation of sample bands by linear regression with extrapolation to zero for each experiment. The density of each sample band was then converted to an absolute quantity using the calibration curve. For each sample band was then converted to an absolute quantity using the calibration curve. For each experiment, the relative band quantity obtained by densitometrric analysis was normalized to the value of the internal control (house-keeping gene) bands which were run in parallel. Identification of differentially expressed genes was based on consistent ford-change across experimental replicates relative to untreate d negative control. Fold changes of ≠¥2- fold or ≠¤0.5-fold were considered as significant. 3.4 Statistical analysis A one-way analysis of variance (ANOVA) was used to determine statistical differences (SPSS version 17;SPSS Inc., Chicago, IL). When the ANOVA was significant at P 0.05 the Duncan’s multiple range test was used for means comparison. The t-test was used to compare between group means.(Alizadeh et al., 2011) 4. Results 4.1 sequence analysis EgRIP-1b The partial cDNA of EgRIP-1b (Dr. Ho personal comment) encodes a putative type I ribosome inactivating protein. The partial sequence consists 167 nucleotide residues. (Fig. 2). This sequence has the highest identity with RIP type I from Populus trichocarpa (98%, XP_002328056.1), Hordeum vulgare (90%, AAA32951.1) and Chain A, Structure Of Mutant Rip From Barley Seeds (90%, 4FBA_A). The NODE_77734GT was classified in a RIP-like superfamily. A putative conserved domain of catalytic residues and some RIP family domain were in this sequence, including that it is a member of the RIP superfamily.(Fig. 5) (Naher et al., 2011) M I C E S I R F E R I S E F L A T E F P G S S K P P K TGATGATCTGCGAGTCGATTAGATTCGAACGCATCTCCGAATTTCTTGCTACCGAATTCCCCGGCAGTTCGAAACCCCCTAAA W M P A L E H G W G D L S A A L L R A D A N P D R P F TGGATGCCGGCACTCGAGCACGGCTGGGGAGATCTCTTTGCCGCGTTGCTGCGCGCCGATGCCAATCCCGACCGTCCCTTCA Fig. 2. The nucleotide and deduced amino acid sequences of NODE_77734GT. 4.2 sequence analysis EgRIP-1a The partial cDNA sequence EgRIP-1a (GenBank ID: ) encodes a protein of 17 amino acid. The sequence consists 178 nucleotides (Fig. 3). This sequences has the highest identity with other type I RIPs from Nicotiana tabacum (47%, ABY71831.1), Musa acuminate (47%, ABY71832.1), Alocasia macrorrhizos (47%, ABY71829.1), Agave sisalana (47%, ABY71828.1) (Fig. 6.a) and (Fig. 6.b) M R P T P N F H Y E W S A CAGGATTCCAGCCGAGCTCCTGCGATAGCCGAACTTCTACCACATGCGACCTACTCCAAACTTCCACTACGAGTGGTCTGCTC L S K Q TCTCCAAACAA Fig. 3. The nucleotide and deduced amino acid sequences of EgRIP-1a. Fig. 4: multiple alignment of NODE with other type I RIPs. Amino acid residues that are identical in all sequences are highlighted in black while amino acid residues that are highly conserved are highlighted in gray; dashes represent gaps introduced to maximize the alignment. (a) (b) Fig. 5: Multiple alignment of EgRIP-1a with other RIPs. The protein sequences and their accession numbers used for analysis of detected sequence. a) Nucleotide residues that are highly conserved are highlighted in gray; dashes represent gaps introduced to maximize the alignment. b) Amino acid residues that are identical in all sequences are highlighted in black with amino acid residues that are highly conserved are highlighted in gray; dashes represent gaps introduced to maximize the alignment. 4.3 Expression profiles (of RIP) in oil palm root upon Ganoderma inoculation A total of 2 cDNA sequences encoding putative defence-related proteins from oil palm were chosen for gene expression profiling in this study. A relative semi-quantification of EgRIP-1b and EgRIP-1b transcripts were performed by calibrating the expression of each gene with an endogenous control, actin. Fig.6 Shows the relative expression level of EgRIP-1b in roots and basal stems in response to the inoculation of G. boninense at different time points compared with that of negative control plants. In G. boninense-treated plants, the gene expression of EgRIP-1b in oil palm roots at 2 wpi was induced. The expression level were n- and n-fold of the uninfected root tissues at 8 and 12 wpi, respectively.(Naher et al., 2011) The expression level was studied in 3 replication of each sample, there were no significant (P>0.05) differences in expression levels in inoculated plants (Alizadeh et al., 2011). EgRIP-1a was up-regulated n-fold and n-fold at X wpi, respectively; before the transcript level decrease at Y wpi in oil palm root tissue following G.boninense infection (Fig). EgRIP-1a expression level were m-, m- and m-fold of the uninfected basal stem tissues at 2,4, 8 and 12 wpi, respectively. EgRIP-1b and EgRIP-1a were not expressed in time zero, untreated samples and leaf tissues. (I) diseased (II) healthy (a) (b) (c) Fig. 6. Differential expression of EgRIP-1b in variety tissues in response to I) G.boninese treatment compare to those in II )control.. a) root tissue, b) stem cell tissue, c) standard (Rippmann et al., 1997) a) b) Fig. 7. Expression level mean in each biological replicate a) in root; b) in stem (I) diseased (II) healthy (a) (b) (c) Fig. 8. Differential expression of EgRIP-1a in variety tissues in response to I) G.boninese treatment compare to those in II) control.. a) root tissue, b) stem cell tissue, c) leaf tissue d)control (Rippmann et al., 1997) a) b) Fig. 9. Expression level mean in each biological replicate a) in root; b) in stem Fig. 10. Semi-quantification of oil palm EgRIP-1a and EgRIP-1b expression levels in root tissues at 2-12 week after inoculation with G.boninense. Significant up-regulation of gene expression compared to untreated negative control. References Alizadeh F, Abdullah SNA, Chong PP, Selamat A Bin (2013) Expression Analysis of Fatty Acid Biosynthetic Pathway Genes during Interactions of Oil Palm (Elaeis guineensis Jacq.) with the Pathogenic Ganoderma boninense and Symbiotic Trichoderma harzianum Fungal Organisms. Plant Molecular Biology Reporter. doi: 10.1007/s11105-013-0595-y Durand-Gasselin T, Asmady H, Flori a, et al. (2005) Possible sources of genetic resistance in oil palm (Elaeis guineensis Jacq.) to basal stem rot caused by Ganoderma boninenseprospects for future breeding. Mycopathologia 159:93–100. doi: 10.1007/s11046-004-4429-1 Ho YW, Nawawi A (1985) Ganoderma boninense Pat . from Basal Stem Rot of Oil Palm ( Elaeis guineensis ) in Peninsular Malaysia. Pertanika 8:425–428. Idris AS, Kushairi A, Ismail S, Ariffin D (2004) SELECTION FOR PARTIAL RESISTANCE IN OIL PALM PROGENIES TO Ganoderma BASAL STEM ROT. Journal of Oil Palm Research 16:12–18. Murphy DJ (2009) Oil palm: future prospects for yield and quality improvements. Lipid Technology 21:257–260. doi: 10.1002/lite.200900067 Paterson R (2007) Ganoderma disease of oil palm—A white rot perspective necessary for integrated control. Crop Protection. doi: 10.1016/j.cropro.2006.11.009 pilotti CA (2005) Stem rots of oil palm caused by Ganoderma boninense: Pathogen biology and epidemiology. Mycopathologia 159:129–137. Rees RW, Flood J, Hasan Y, et al. (2009) Basal stem rot of oil palm ( Elaeis guineensis ); mode of root infection and lower stem invasion by Ganoderma boninense. Plant Pathology 58:982–989. doi: 10.1111/j.1365-3059.2009.02100.x Rees RW, Flood J, Hasan Y, Cooper RM (2007) Effects of inoculum potential, shading and soil temperature on root infection of oil palm seedlings by the basal stem rot pathogen Ganoderma boninense. Plant Pathology. doi: 10.1111/j.1365-3059.2007.01621.x Tan Y-C, Yeoh K-A, Wong M-Y, Ho C-L (2013) Expression profiles of putative defence-related proteins in oil palm (Elaeis guineensis) colonized by Ganoderma boninense. Journal of plant physiology. doi: 10.1016/j.jplph.2013.05.009

Winter Dreams, F. Scott Fitzgerald Analysis

Winter Dreams, F. Scott Fitzgerald Analysis F.Scott Fitzgeralds Winter Dreams documents the life of Dexter Green, a young man from a modest background who strives to be a part of the exclusive world inhabitated by the women he loves (Perkins 1). The work regards a period in Dexter Greens life, from the age of fourteen to thirty two. Fitzgerald divides the story into six episodes through those eighteen years, and each episode relates to Dexters relationship to Judy Jones. Judys love is what Dexter yearns for; she pushes him to his vision of the perfect life filled with glittering things, wealth and a high social status (Fitzgerald 423). The life Dexter desires is the American Dream in being successful, but it does not always mean being happy, Fitzgerald uses the elements of symbolism, and imagery throughout his short story Winter Dreams to represent his theme. Winter Dreams signifies more than the basic understanding of the title. The symbolism used in the title, adds a depth to the story and displays the theme of the unhappy, wealthy life. Throughout the years Dexters life changes and the aging process is signified by the word winter in the title, but winter also signifies a transition that is more tragic than physical deterioration; by the end of the story, Dexters emotions have become frozen (Gidmark 2). Gidmark shows the double meaning, symbolism in the word winter by explaining both its connotations. Not only does the word winter stand for the weakening of Dexter, but it also signifies how his mood and feelings become iced up, and unchangeable because of his heart break. The first introduction of Dexters dream is described as, [it] happened to be concerned at first with musings on the rich, [à ¢Ã¢â€š ¬Ã‚ ¦] he wanted not association with glittering things and glittering people-he wanted the glittering things themselves (Fitzgerald 42 3). The glittering things include money and success which Dexter yearns for. Not only does he want to associate with them, he also wants the achievement to be his own. Gidmark clearly analyzes Judys role in the short story, [she] is the picture of passion and beauty, energy and loveliness, the true love and true dream that are with him until, learning of Judys decline, he recognizes it as a signal of the demise of his own dreams (2). Judy is what keeps Dexters dream going on, and without her his dream comes to a termination. According to Prigozy, Judy Jones comes to symbolize both the beauty and the mereticiousness of Dexters dreams- is clearly revealed as cruelly, coldly destructive (1). Even though his dream of Judy keeps him going, she is also a negative influence upon him because of her bitter heart. Judys image to the world shows her as living a very pleased life with new men on her tail constantly, but inside she is alone and scared. Dexters youthful winter dreams became very closely related to Judy Jones and his love for her that, the imaginative present in which she remains alive for Dexter also preserves that youthful richness (Clinton 405). His need for her approval of the triumphant American lifestyle is what keeps his dream and himself lively. Fitzgerald displays what is going on, The dream was gone. Something had been taken from him (435). Gidmark explicates Fitzgeralds quote, about when Dexter loses the capability of feeling and caring, he states, [Dexters] dream of Judy had kept him energetic, passionate, and alive, and now the dream has been taken from him, (2). Judy and Dexters relationship ended a while back, but Dexter still latched on to his dream. Imagery in the short story, Winter Dreams produces mental pictures in ones head, depicting the theme. The images are used in order to, [keep] alive his love for Judy Jones and the brightness of his youthful winter dreams in the only way the past can remain alive- by fixing its images out of time and the real world in an imaginative present (Burhans 4). In the beginning of the story, Dexter describes the Minnesota winter [it] shut down like the white lid of a box (Fitzgerald 421). The scenery mirrors his depression, because while he wants a golden future he is living in a dark cold life. The simile depicts how Dexter views his dreams, by being shut down and closed. Fitzgerald utilizes another simile about Dexter, when he crossed the hills the wind blew cold as misery (Fitzgerald 421). The simile draws a mental picture, and the word misery describes the melancholy currently in his life. Dexter grows and starts to become a successful man, suddenly, the sun went down with a riotous swirl of gold and varying blue and scarlets, and left the dry, whistling night of Western summer (Fitzgerald 425). Now the dark images of the landscape have transformed into a delightful scene, because Judy and Dexters relationship begins. Fitzgerald uses gold in the setting to represent Judy, and the gold in the images is present when Dexter is still reaching for his dream. Dexter is informed that Judys perfect life is now turned into a tragedy. She is married to a man who treats her poorly, and her beautiful charm is gone. After his harsh realization of Judys present life Dexter feels, The grief [I] could have borne was left behind in the country of illusion, of youth, of the richness of life, where [my] winter dreams had flourished (Fitzgerald 436). He becomes emotionless, and his dreams quickly become the past. Shattered, he is now feeling vacant and lonely because his ideal girl is suffering. Burhans expresses how Dexter is in misery when he cannot remember the beautiful scenery, go ne, too is a part of himself also deeply associated with and still alive in these images: the fragile moment in time when youth and his winter dreams were making his life richer and sweeter than it would ever be again (2). The earlier illustrations, green and open spaces of the golf-course days in Minnesota are gone, replaced by the constricting, cold, grey cement and steel of a skyscraper (Flibbert 2). The cold and grey construct an image of bitter and lonesomeness. He cannot revive the green grass and yellow sun shining; now the picture is substituted with a harsh one. Fitzgerald explains Dexters emotions, he had married Judy Jones and seen her fade away before his eyes (435). He held Judy in the most special place within himself and now his perfect image of her is destructed. He cannot revitalize her beautiful face, with his realization of her, his images have disappeared. Throughout the short story, Winter Dreams by F.Scott Fitzgerald, the theme of the ideal American life, of money and wealth is represented. The dream of this particular lifestyle does not consider one truly being happy or not. The protagonist in the story, Dexter achieves this life but ends with a tragic downfall. He starts off wanting to be successful and once he achieves his goal, Judy Jones comes into his life. She is the continuous dream in his life, and when he discovers that Judy has ended up unhappy his dream shatters. He ends up unhappy and frozen. Fitzgerald uses literary devices, such as symbolism and imagery to prove his theme in an intellectual way, with depth.

Seeking Harmony as a World Citizen Essay -- Personal Narrative Essay E

Seeking Harmony as a World Citizen "Excuse me, do you speak German?" - outside of that church's organ recital in Bonn, Germany, the distinct Japanese accent caught me by surprise. My weeks of study and internship gave me new confidence, so I answered, "Yes, yes I do." The Japanese woman's companion, seeing my nod, immediately began to overflow with German praises. I looked at her, elderly, in a wheelchair, and she told me the story: that music-loving Japanese woman pushed that music-loving German woman out of the church, medieval in design and thus not disabled-friendly. "What generosity," I translated in my native tongue, the only go-between these women had. "A million thanks for your help, I couldn't have made it out without you." The Japanese woman nodded, understanding, but her only reply was, "Does she need me to take her somewhere else?" "No, no, and thank you - God bless," I translated. The German woman smiled, grabbed her hand, kissed it. She grabbed my hand, kissed it too, and wheeled away over the cobblestones. Awestruck, I smiled to the Japanese w...

Buddhism Essay -- essays research papers

The followers of the Buddha believe life goes on and on in many reincarnations or rebirths. The eternal hope for all followers of Buddha is that through reincarnation one comes back into successively better lives - until one achieves the goal of being free from pain and suffering and not having to come back again. This wheel of rebirth, known as samsara, goes on forever or until one achieves Nirvana. The Buddhist definition of Nirvana is "the highest state of spiritual bliss, as absolute immortality through absorption of the soul into itself, but preserving individuality" (Head1 57). Birth is not the beginning and death is not the end. This cycle of life has no beginning and can go on forever without an end. The ultimate goal for every Buddhist, Nirvana, represents total enlightenment and liberation. Only through achieving this goal is one liberated from the never ending round of birth, death, and rebirth (Head3 73). Transmigration, the Buddhist cycle of birth, death, a nd rebirth, involves not the reincarnation of a spirit but the rebirth of a consciousness containing the seeds of good and evil deeds. Buddhism's world of transmigration encompasses three stages. The first stage in concerned with desire, which goes against the teachings of Buddha, is the lowest form and involves a rebirth into any number of hells. The second stage is one in which animals dominate. But after many reincarnations in this stage the spirit becomes more and mo... Buddhism Essay -- essays research papers The followers of the Buddha believe life goes on and on in many reincarnations or rebirths. The eternal hope for all followers of Buddha is that through reincarnation one comes back into successively better lives - until one achieves the goal of being free from pain and suffering and not having to come back again. This wheel of rebirth, known as samsara, goes on forever or until one achieves Nirvana. The Buddhist definition of Nirvana is "the highest state of spiritual bliss, as absolute immortality through absorption of the soul into itself, but preserving individuality" (Head1 57). Birth is not the beginning and death is not the end. This cycle of life has no beginning and can go on forever without an end. The ultimate goal for every Buddhist, Nirvana, represents total enlightenment and liberation. Only through achieving this goal is one liberated from the never ending round of birth, death, and rebirth (Head3 73). Transmigration, the Buddhist cycle of birth, death, a nd rebirth, involves not the reincarnation of a spirit but the rebirth of a consciousness containing the seeds of good and evil deeds. Buddhism's world of transmigration encompasses three stages. The first stage in concerned with desire, which goes against the teachings of Buddha, is the lowest form and involves a rebirth into any number of hells. The second stage is one in which animals dominate. But after many reincarnations in this stage the spirit becomes more and mo...

Teaching Philosophy :: Education School Essays

Teaching Philosophy Children are our future and it has been a dream of mine to guide them into the right direction by the way of a good education. Having two children of my own, and preparing them for school, prompted me to want to achieve my goal of teaching. Watching their faces beam with pride as they learned something new, made me so proud. Teaching them preschool activities required research in knowing what I should teach to prepare them for elementary school. I used workbooks that I purchased from stores and I printed out worksheets from the Internet to help them learn. I considered myself a traditionalist; I directed the activities and had emphasis on a core curriculum that I planned for daily. After seeing them succeed from my teaching efforts, I decided I wanted to help other children succeed. I believe the purpose of education is to gain knowledge and to know how to use it to be successful in life. Without an education, a productive life cannot be had. I hope that I can always instill in my students the desire to want to know more and therefore become more knowledgeable. I want them to be excited about learning and not to look at school as a punishment. I want them to realize every goal they may have can be reached through a good education. I want to see all of my students succeed and I want them to know that I will do anything to help them. Anytime a student should need my guidance, I will do my best to help. I want them to not only gain knowledge, but to also have self-confidence and to be proud. I know, from experience, when a child is struggling in school, their self-confidence is low and their grades will reflect it. However, when a child finally grasps the knowledge he needs, his self esteem will soar as well as his grades. It's so important that s tudents feel good about themselves and I want to make sure I can do my part in making sure that happens. My classroom will reflect a realist philosophy. I will have a linear seating arrangement and they will all face the blackboard. Teaching Philosophy :: Education School Essays Teaching Philosophy Children are our future and it has been a dream of mine to guide them into the right direction by the way of a good education. Having two children of my own, and preparing them for school, prompted me to want to achieve my goal of teaching. Watching their faces beam with pride as they learned something new, made me so proud. Teaching them preschool activities required research in knowing what I should teach to prepare them for elementary school. I used workbooks that I purchased from stores and I printed out worksheets from the Internet to help them learn. I considered myself a traditionalist; I directed the activities and had emphasis on a core curriculum that I planned for daily. After seeing them succeed from my teaching efforts, I decided I wanted to help other children succeed. I believe the purpose of education is to gain knowledge and to know how to use it to be successful in life. Without an education, a productive life cannot be had. I hope that I can always instill in my students the desire to want to know more and therefore become more knowledgeable. I want them to be excited about learning and not to look at school as a punishment. I want them to realize every goal they may have can be reached through a good education. I want to see all of my students succeed and I want them to know that I will do anything to help them. Anytime a student should need my guidance, I will do my best to help. I want them to not only gain knowledge, but to also have self-confidence and to be proud. I know, from experience, when a child is struggling in school, their self-confidence is low and their grades will reflect it. However, when a child finally grasps the knowledge he needs, his self esteem will soar as well as his grades. It's so important that s tudents feel good about themselves and I want to make sure I can do my part in making sure that happens. My classroom will reflect a realist philosophy. I will have a linear seating arrangement and they will all face the blackboard.

Comparing Debt Financing and Equity Financing Essay -- Financing Finan

There are two basic ways of financing for a business: Debt financing and equity financing. Debt financing is defined as 'borrowing money that is to be repaid over a period of time, usually with interest" (Financing Basics, 1). The lender does not gain any ownership in the business that is borrowing. Equity financing is described as "an exchange of money for a share of business ownership" (Financing Basics, 1). This form of financing allows the business to obtain funds without having to repay a specific amount of money at any particular time. There are also a few different instruments that could be defined as either debt or equity. One such instrument is stock options that an employee can exercise after so many years with the company. Either using the debt or equity method, or a combination of the two methods can be used to account for stock options or other instruments with the similar characteristics. There are pros and cons to deciding to use either of these methods. First I will discuss the pros of using the debt or equity methods. One pro of using the debt method is that it "does not entail 'selling' their equity, but instead works by 'borrowing' against it" (Financing Using, 1). So the company could account for future stock options by assuming that employees will cash the option in, and, in the books, it will look as if they simply have a liability. Another pro with the equity method is that the company is receiving money, and it does not have to pay the money back. In the end the investing company will normally make money on the investment, but it will come in the form of dividends and/or selling the stock back. There are also a few cons in accounting for these instruments are either debt of equity. "Excessive debt financing may impair your (the company's) credit rating and your ability to raise more money in the future (Financing Basics, 1). If a company has too much debt, it could be considered too risky and unsafe for a creditor to lend money. Also with excessive debt, a business could have problems with business downturns, credit shortages, or interest rate increases. "Conversely, too much equity financing can indicate that you are not making the most productive use of your capital; the capital is not being used advantageously as leverage for obtaining cash" (Financing Basics, 1). A low amount of equity shows that the owne... ...n Shares 400 This would be a very efficient way of accounting for the stock options. There will not be many changes in amounts when the employee has the option. This would be the entry for five years, and then the employee will have their option. Below is the journal entries for both decisions: Employee takes the cash Common Shares 2000 Accounts Payable 500 Cash 2500 Employee takes the stock Accounts Payable 500 Common Shares 500 Again, both methods clear out the accounts payable. Also the employee is receiving the cash or common shares in the right amount. Debt and equity methods are important decisions when deciding what to do with an instrument like stock options. All three methods, debt, equity, or a combination, are helpful in keeping the books correct and fair until the employee exercises their option. The best method in my mind is the combination of methods. It best shows were the money will go on average before the option is decided on. However the other two methods are also important considering the pros and cons of each decision. No clear answer, however, will ever be known as long as accounting exists.

Isolation in Bartleby the Scrivener :: Bartleby Scrivener Essays

Isolation in Bartleby the Scrivener "I prefer not to," "I prefer not to," tells the reader about Bartleby isolating himself. The phrase shows his lack of involvement, another form of isolation. The narrator tells the reader exactly what he did to Bartleby, very vividly, as shown below. In the novella, the author tells the reader, down to the smallest detail, what he did to Bartleby to isolate him from the world. He tells us in this passage, "I placed his desk close up to a small side window in that part of the room, a window which originally had afforded a lateral view of certain grimy backyards, and bricks, but which, owning to insubsequent erections, commanded at present, no view at all, though it gave some light. Within three feet of the panes was a wall, and the light came down from far above between two lofty buildings, as from a very small opening in a dome. Still further to satisfactory arrangement, I procured a green folding screen, which might entirely isolate Bartleby from my sight, t hough, not remove him from my voice." The quotation describes how the narrator secludes Bartleby from society. Even his window, usually a form of escape, results in Bartleby being trapped behind another wall, thus reinforcing his total isolation. The irony lies in the fact that the narrator, while trying to isolate Bartleby, becomes affected by it, so much so that he appears almost human. Instead of dismissing him on the spot for refusing to copy, proofread or leave the premises, he tries to find other employment for him, and even considers inviting him to live in his residence as his guest. The narrator develops before our eyes into a caring person, very different from the cold, unsympathetic person at the beginning of the story. "To befriend Bartleby, to humor him in his strange willfulness, will cost me little or nothing, while I lay up in my soul what will eventually prove a sweet morsel for my conscience." The narrator would normally befriend Bartleby or any othe r "sucker," but Bartleby has given him a conscience. The narrator has realized that a common blemish in a person does not determine the person. In the beginning of the novella, the narrator only cared about his work, but now he realizes that people have a life outside of work, except Bartleby.