A grammar test to an intermediate level Assignment

A grammar test to an intermediate level - Assignment Example For a longtime teachers have had a hard time trying to determine whether their students have grasped the various learning concepts tests were therefore introduced to enable teachers asses the learning levels of their students (Harmer 2007, Pg 2). Prior to any testing exercise, teachers often put many factors into consideration, such, may include the age of the students, the topics covered under study. One of the importances of testing the intermediate students English language levels is that it helps the teacher make various decisions regarding the teaching models to use.   Teachers have various styles of teaching and such may affect the students understanding of the given topic (Hughes 1989, pg 15).   The testing therefore enables teachers to tailor their teaching styles to fit the students that are being taught. In the face of ever changing English and language developments, the testing of students gives them exposure to these changes. Students at intermediate levels may not ha ve so much grasp and command of the English language, however, through testing the teachers may introduce elements that will be suitable for their learning (Yule, 2000 Pg 17). Therefore, testing of this kind allows the teacher to determine what the learners ought to know and the various changes that are talking place in the English language. Through testing, the teacher will be able to know the various interests of the learners especially in regards to the learning styles applicable in teaching them.   For instances students that are convergers.... Prior to any testing exercise, teachers often put many factors into consideration, such, may include the age of the students, the topics covered under study. One of the importances of testing the intermediate students English language levels is that it helps the teacher make various decisions regarding the teaching models to use. Teachers have various styles of teaching and such may affect the students understanding of the given topic (Hughes 1989, pg 15). The testing therefore enables teachers to tailor their teaching styles to fit the students that are being taught. In the face of ever changing English and language developments, the testing of students gives them exposure to these changes. Students at intermediate levels may not have so much grasp and command of the English language, however, through testing the teachers may introduce elements that will be suitable for their learning (Yule, 2000 Pg 17). Therefore, testing of this kind allows the teacher to determine what the learne rs ought to know and the various changes that are talking place in the English language. Through testing, the teacher will be able to know the various interests of the learners especially in regards to the learning styles applicable in teaching them. For instances students that are convergers are often solitary and may not like learning in the same environment as the others (Yule, 2000 Pg 17). Through this the teacher will be in a position to identify the conformist students who have preference to studying the language rather than using the language. Others like concrete learners and the communicative learners will also be identified and the teacher will come up with various teaching models that are suitable for them. Having knowledge on the type of students in your

Law of Contract Case Study Example | Topics and Well Written Essays - 750 words

Law of Contract - Case Study Example The requirement for the program is usually postpones or suspended for a limited period of time, and may require notice in order to rely on the contractual clause."1 Whether the bad weather can classified as force majeure making the delay acceptable is dependent upon the force majeure clause in the building contract that the parties entered into. Said clause should contain: According to the case of Paradine v Jane3, it is necessary to adhere to the strict and literal application of contractual terms. In that case the defendant refused to pay rent since he was no longer in possession of the land. The defendant was made to pay rent since the court ruled that there was no express or implied terms within their contract to grant a reprieve in such circumstances. In the event that the agreement between the parties does not clearly state or cover the issues at hand, the basic agreement contained in UK law regarding Force Majeure is found in the Standard Building Contract or SBC Item 13. The SBC states that a contractor is entitled to an extension of time in cases of "other relevant events such as exceptionally adverse weather conditions, specified perils, civil commotion or terrorism, strike and the execution by the UK government of any statutory power which directly affects the execution of the works after the base date."4 The performance of the obligation is deemed suspended until the passing of the force majeure and thus it will create the effect of extending the time allotted to finish obligation as discussed in the case of Tenneco Canada Inc. V British Columbia Hydro and Power Authority.5 Accordingly if the workers strike, a circumstance considered by the court as a force majeure, caused the direct cessation of the Tenneco's electric supply then Tenneco would be granted a reprieve from payment of the monthly demand charge on top of the electricity bill. But since the stoppage of work caused by the strike did not prevent Tenneco from using the electricity hence he must pay the consequent monthly demand charge. The obligation to pay was not deemed suspended. In the case of Snograss the inclement weather condition caused work stoppages and delays, hence the period to complete the obligation must be suspended pending the passage of the force majeure. This being the rule of law, Snodgrass contention is valid. The reason of force majeure causing the delay is valid. The additional time of 10 days it took Snodgrass to finish the first fifty bungalows is valid and reasonable. Hence the breach of contract is excused and the Newchestham Borough Council cannot terminate the same nor is it entitled to

The first experiment Essay Example for Free

The first experiment Essay In the three experiments, we see how different objects fall. We should take note that the experiments are employed with the presence of air (and thus, air friction). In the first case, the quarter dollar coin is bigger and heavier than the penny; therefore, it will drop faster because its gravitational force is greater than that of the penny. Even if there is an air friction which is opposite the direction of gravity, it only has a minimal effect on the coins. In the second case, the crumpled paper falls faster than the uncrumpled one. This is because the presence of air friction acts greater with the uncrumpled paper as its surface is greater, hence creating a bigger space for air friction to occur. The crumpled paper, on the other hand, falls faster because of its compacted state. Its gravitational pull acts greater than the opposing air friction. Thirdly, the case of the coin dropped from the index card accounts for the coin to fall faster. This is because it has greater mass (and therefoe, greater gravitational force) tan the index card. Generally, the mass and weight of an object are major characteristics to consider in predicting its rate of fall. The greater the mass or weight, the faster will it fall. This is primarily due to the fact that gravitational force is mass (m) times acceleration die to gravity (g = constant at 9. 8 m/s2). In the same way, the shape and surface of an object also contribute to its rate of fall. The more compact or solid the object, the faster it will fall; the bigger the surface area, the more slowly it will fall. The frictional force is responsible for this slow down. 2. Describe the difference (in both what happens and why) between a person who jumps from an airplane with a parachute and one who jumps without a parachute. If a parachute is used, what would be the difference when the same size parachute is used on a person and then used on an elephant? In the first instance where a person jumps from an airplane with a parachute (say, person A), as compared to the person without a parachute (person B), person A will be able to land in a safer manner since the chute provides for a decrease in the person’s acceleration towards the ground. As person A drops down, the chute slows down his velocity by adding the oppositely directed air friction; meaning, as the downward velocity increases (or as person A accelerates downward), an upward force (which is the air friction sifted by the parachute) reduces the acceleration, thus creating less impact on person A’s landing. Contrastingly, person B will drop downwards in an accelerating manner, where the increased velocity will account for a less safe landing. In the second instance, the size is given focus with regard to the velocity and acceleration of the falling person/animal. Given the same sizes of parachutes used, a person (say, person C) and an elephant (say, Dumbo) are dropped down from an altitude. The effect would be that Dumbo will fall faster than person C despite the same sizes of chutes. Dumbo’s size accounts for the increase in velocity, as it has been established that mass is a factor for acceleration according to Newton’s First Law of Motion (F = ma or a = F / m). Person C will then fall more slowly as compared to Dumbo’s acceleration. The parachute may provide a decrease in acceleration, but this is more observable in person C’s experience.

My Mother Essay Example for Free

My Mother Essay The film centers on Manuela, a nurse who oversees donor organ transplants in Ramà ³n y Cajal Hospital in Madrid and single mother to Esteban, a teenager who wants to be a writer. On his seventeenth birthday, Esteban is hit by a car and killed while chasing after actress Huma Rojo for her autograph following a performance of A Streetcar Named Desire, in which she portrays Blanche DuBois. Manuela has to agree with her colleagues at work that her sons heart be transplanted to a man in A Coruà ±a. After traveling after her sons heart, Manuela quits her job and journeys to Barcelona, where she hopes to find her sons father, Lola, a transvestite she kept secret from her son, just as she never told Lola they had a son. see more:speech about my mother In Barcelona, Manuela reunites with her old friend Agrado, a warm and witty transsexual prostitute. She also meets and becomes deeply involved with several characters: Rosa, a young nun who works in a shelter for battered prostitutes and is pregnant by Lola; Huma Rojo, the actress her son had admired; and the drug-addicted Nina Cruz, Humas co-star and lover. Her life becomes entwined with theirs as she cares for Rosa during her pregnancy and works for Huma as her personal assistant and even acts in the play as an understudy for Nina during one of her drug abuse crises. On her way to the hospital, Rosa asks the taxi to stop at a park where she spots her fathers dog, Sapic, and then her own father, who suffers from Alzheimers; he does not recognize Rosa and asks for her age and height, but Sapic is cleverer and knows Rosa. Rosa dies giving birth to her son, and Lola and Manuela finally reunite at Rosas funeral. Lola (whose name used to be Esteban), who is dying from AIDS, talks about how she always wanted a son, and Manuela tells her about her own Esteban and how he died in a car accident. Manuela then adopts Esteban, Rosas child, and stays with him at Rosas parents house. The father does not understand who Manuela is, and Rosas mother says its the new cook, who is living here with her son. Rosas father then asks Manuela her age and height. Manuela introduces Esteban (Rosas son) to Lola and gives her a picture of their own Esteban. Rosas mother spots them from the street and then confronts Manuela about letting strangers see the baby. Manuela tells her that Lola is Estebans father; Rosas mother is appalled and says: That is the monster that killed my daughter?! Manuela flees back to Madrid with Esteban; she cannot take living at Rosas house any longer, since the grandmother is afraid that she will contract AIDS from the baby. She writes a letter to Huma and Agrado saying that she is leaving and once again is sorry for not saying goodbye, like she did years before. Two years later, Manuela returns with Esteban to an AIDS convention, telling Huma and Agrado, who now run a stage show together, that Esteban had been a miracle by not inheriting the virus. She then says she is returning to stay with Estebans grandparents. When asking Huma about Nina, she becomes melancholic and leaves. Agrado tells Manuela that Nina went back to her town, got married, and had a fat, ugly baby boy.

The Effect Of Games On Vocabulary Learning

The Effect Of Games On Vocabulary Learning Learning another language has always been problematic for learners. How and what skills should be learned has been a matter of inquiry. It is true that integrating language skills and component is against the nature of language and language should learn holistically, but some components of language, like vocabulary, are the building block of learning. Vocabulary learning and teaching has had a long history in second language learning field, sometimes it has been the focus of attention and sometimes its margin; but it has never been absent. About six hundred experimental reports published over the last twenty -five years, indicates the significant role of vocabulary in L2 learning (Brown, Rodgers, 2002). In addition, different scholars mentioned the central role of vocabulary; Vocabulary knowledge is crucial to reading comprehension(Mosher, 1999, p.9;cited in klepper,2003,p.4); Mastering English vocabulary is crucial for ESL student to become language competent (Avila Sadoski, 1996; cited in Gaudio, 2003, p.18); Without grammar very little can be conveyed, without vocabulary nothing can be conveyed( David Wilkins; cited in Thornbury, 2002, p.13) . If you spend most of your time studying grammar, your English will not improve very much. You will see most improvement if you learn more words and expressions. You can say very little wi th grammar, but you can say almost anything with words (Dellar Hocking; cited in Thornbury, 2002, p.13). L2 learners are the ones who struggling with learning and the first weapon used in this struggle is dictionary (Krashen, 1997; citied in Brown, Rodgers, 2002) so it is evident that they are more aware of vocabulary role than scholars and researchers. Sometimes, I am a lack of useful vocabularies to express my opinions. And too often my speaking is hard caused by missing word; these are how learners mentioned their needs of vocabulary in Thornburys book (Thornbury, 2002, p.13). What has been done in this field, remains no doubt in the importance of vocabulary on both scholars and learners side. However, which approach to take in order to make vocabulary teaching more effective, is still a question. According to scholars, learning vocabulary through games is one effective and interesting way that can be applied in any classrooms( Thanh Huyen, Thu Nga,2003 , Learning Vocabulary Through Games,para.1) Using games as an educational tool is not something new and had a long history in language teaching. Games were used for more repetition in Audio lingual; they were introduced in Desuggestopedia as role-play activities or other activities aiming to reduce language barriers; most activities in TPR were game like ones to insert fun in classroom environment; and they found to be handy in Cooperative language teaching, in order to maximize the learner- learner interaction. This long story may prove the effectiveness of games; however, what is the role of games in vocabulary learning? Moreover, do games truly have educational value? To answer this question systematically, as Klepper suggested (2003), to form a basis for researching the effectiveness of games used in vocabulary instruction (p.4), it would be useful to review researches done in related idea; like the effect of games on student retention and memory, and motivation. To start, it would be a good idea to review games and memory in vocabulary teaching and learning. One of the teachers desires is to see their students retain what have been taught. To realize this wish, learners should memorize and recall the information in this field (vocabulary) accurately. Frequently asked question by student is how to memorize and recall what they have learned. Even highly motivated learners facing the difficulty of memorizing vocabulary lose their motivation, because memorizing requires them to make efforts to keep increasing vocabulary accurately. Vocabulary needs great repetition drills to establish (Atake, 2003). It is true that drills are sometimes boring, but there is a simple solution for this problem, insert games to make drills fun. Games bring in relaxation and fun for students, thus help them learn and retain new words more easily( Thanh Huyen, Thu Nga,2003 , Learning Vocabulary Through Games,para.1). For learning vocabulary, learners need to be able to remember long term. Information, first is held in short-term memory and by lack of attention, it is quickly lost. In order for the information in the short term to be retained, enough rehearsal and elaboration is needed. The more that the knowledge is rehearsed in the memory the more likely it is to be retained in long term memory (Klepper, 2003). It is important to keep student attention, in order to increase their ability to retain words. One way to keep students attention as scholar suggested is emotion. When an educator creates emotion, such as in a game format, music, or drama, then the students attention is most likely to remain with the material and task at hand. In addition, using this strategy directly after a lesson increases the chances that the material will be recalled later.(Meyen, et. al.1999,cited in Klepper, 2003) The other related field is games and motivation. We know that motivation is the root problem in learning. Without due attention to motivational inputs, they [output or ends of learning] are rarely achieved (Clark, 2007, p.11). In order to achieve learning goal, teachers should pay attention to motivating strategies and One of these strategies used by teachers, as Hootstein (1994) mentioned, is using games. While you are teaching, sometimes you feel your students are just physically in the class, and what happen to attention? Not even a sign of it, what is the reason? As Ersoz (2002) mentioned, language learning is a hard task which can sometimes be frustrating. Constant effort is required to understand, produce, and manipulate the target language (p.1). It is hard for students to keep trying to overcome their frustration and unfortunately, it is possible for students to easily lose their motivation (Atake, 2003, p.9). When learners face so many essential words to comprehend and produ ce a language, they will find learning a burden. This burden is so heavy that makes even highly motivated learners, demotivate. Research shows that games can serve to motivate and interest student in learning (Hogle, 1996, p.8-10). Most scholars ( Wright, Betteridge , Buckby , 1984; Ersoz , 2000; Su Kim, 1995; Uberman, 1998; Lee,1979;Richard-Amato, 1988; Hansen, 1994; Wierus and Wierus, 1994; Zdybiewska, 1994; Thanh Huyen Thu Nga, 2003; Yong Mei Yu-jing, 2000; Lewis, 1999;Tyson, 2000; Lengeling Malarcher, 1997) believe in the significant role of games in EFL field specially vocabulary development in addition some complained about the negligence of its importance; as Lee stated, a game should not be regarded as a marginal activity filling in odd moments when the teacher and class have nothing better to do (Language teaching games and contests, 1979; cited in Using Games in EFL Classes for Children,2000 ). He also says that games should be treated as central not peripheral to the foreign language teaching program. Thanh Huyen and Thu Nga,also aptly mentioned the advantages of using of games: Games have been shown to have advantages and effectiveness in learning vocabulary in various ways. First, games bring in relaxation and fun for students, thus help them learn and retain new words more easily. Second, games usually involve friendly competition and they keep learners interested. These create the motivation for learners of English to get involved and participate actively in the learning activities. Therefore, the role of games in teaching and learning vocabulary cannot be denied. ( 2003 , Learning Vocabulary Through Games,para.1) However, considering games, as the central activity does not mean it is a safe way to stick to it and call it super technique. It can be said that games are an effective tool, but as Thanh Huyen and Thu Nga themselves observed, a matter of caution still remains: However, in order to achieve the most from vocabulary games, it is essential that suitable games are chosen. Whenever a game is to be conducted, the number of students, proficiency level, cultural context, timing, learning topic, and the classroom settings are factors that should be taken into account.( 2003 , Learning Vocabulary Through Games,para.1) So games are effective as long as their style, as Dunne (1984) reported, match with subject matter and types of student.

Identify the Purposes of Different Types of Organisation

Identify the Purposes of Different Types of Organisation A business organization when formed it has to adapt some proper decision regarding its future establishment and the overall prosperity or sustainability. So it is very important to measure many economic, cultural, political variables under which the development of a business organization depends. So the environment for a business organization is a very important issue. Before forming an organization the entrepreneur have to justify the environment whether it is business friendly environment. Whether there is any risk matters regarding the financial market or institution or the current economy is healthy. Risk may arise now and then so the entrepreneurs have to alert of it. The purpose of different types of organization: Richard Koch (1997) defines there are only some basic concepts about organization. It is thought before that organization is a group of people who used to share the same purpose like a company organization, a university, or a fund. And with the comprehensive lesson, it is learnt that though there are a lot of organizations who are involved in business activities, they can be classified under three main classes, they are private sector, public sector, and third-sector organizations.it is described the mission, vision and goalpolicy of a company as being defined the primary purpose of the firm, what business it should be, whom the company is going to serve and satisfy for the rest of the time. So the, the organization activities should evolvefrom the mission and goal statement. So many companies, in order to make sure the employee remember about their roles and duties perused to them, they have mission and goal statements on future activities.Moreover, Vision builds up on the goals and objectives, that is, what the organizations ultimate aims or the destiny to grow in the future. The vision statement as a long-term aimof how the organization that is to be shaped in the futuredevelopment and what it could become more profitable. Moreover, he clearly distinguished the mission that is the companys role and future objectives; the vision, that is, what the company could turn into the future sustainability. The extent to which the organization meets the objectives if different stakeholders: What actually is a stakeholder? That is a wide range of discussion, it can be defined that a stakeholderas a person, group, organization, who affects or can be affected by an organizations actions or course of actions.For performing good project management activities, anyone needs to both manage and meet stakeholder expectations and demands. As a result of the assessment should match their wants and demand for what will be provided at the end of the assessment. Why would an organization look at it to use software to assist them with that? Definitely project management software cannot meet the stakeholder objectives and their service, but it is important tool that is in the Project Managers area to facilitate meeting the demand and objectives. (Prasanna Chandra, 2010). Responsibility of an organization and strategies: An organization communicates with stakeholders such as employees, customers, government, suppliers local communities, different ethnic groups intermediaries, financiers. Stakeholders have wide expectations to the company that they require the organization to fulfill, them. Employees expectation to the organization is to pay their salaries and bonuses on due time while the government expects the firm to pay its taxes as soon as possible. Diana Wicks (n. d) demonstrates that the management should also justify other positive and negative external and internal factors such as legislation policies and economic situations that have a direct impact on a firms survival.Business ethics loyalty and good governance form a part and parcel of social responsibility and liability. Business morality concerns the ethical judgments and behavior of persons and groups within company. Stakeholders expect organizations will be responsible for their actions and clarify in their transactions, in addition to respecting the societys norms and customs. The organization should also to ensure that it maintains those activities that contribute to the organizations success while c ontemporarily contributing positively to the welfare of society and country. How economic systems attempt to allocate resources effectively: An economic system is resulted from individuals (consumers and producers, suppliers), groups (firms, trade unions, political parties, etc. and the government interactsas a legal and social entity for the economy. The function of an economic system is based on to resolve the basic economic problem that is demonstrated scarcity means the limitation of resources but our wants are infinite so there is an imbalance. There is three questions arise: What has to be produced? How it has to be produced? For whom it has to be produced? There are two economic systems which are frequently used by world-wide. There are called: the free market system in which the government plays a limited role but that is a vital role and the system which is planned where the government takes fully total control on the circulation. In both of these systems there are different elements of resource allocation that is used by the government. There are economies that use a combination of these two processes in particular the planned and free market process also known as the mixed economy system in which many of the decisions about the resource allocation are taken by the government and other by the rest of the government or public.(Festina, 2005). Impact of the fiscal and monetary policies: It talks about current and future strategies of company. The selection first selects the competitors by their assets sales focus of business or geographic reach. In this case all the competitors are profit oriented or making profits. All financial and marketing strategies are discussed in this section. Comparative financial analysis: this section compares the financial standing of competitors with this company. Financial performance of each segments are discussed here. The objectives of these sections are to evaluate the position of ours and our competitors. Stock price comparison helps to understand the financial performance of others. International trade: buying and selling the goods across the borders is known as international trade. International is considered as backbone of a country in new commercial world. The companies are trying to expand the market beyond the borders to make a better profit rather than limiting it in local borders. There are more few reasons for doing business across the borders. One of the vital components of international trade is lower cost in developing nations. Clearly, a company that can pay its workers the equivalent of dollars a day, as compared to dollars an hour, has a distinct selling advantage.so the company has more potential to expand its business though it has the vast business throughout the world. It is also the .vital point of sustaining the market of the business. (Ukessays, n, d) How market structures determine pricing and output decisions in business: The pricing is fully dependent on the competition on the market. According to a research on Transcom global Inc. (2013).In order to interpret the price-output decisions of entity and industry, it started with the description of several market structures under perfect competition, perfect competition, and simplemonopoly, the discriminating started on the monopoly, monopolistic competition, and duopoly. Oligopoly, monopoly and bilateral monopoly the degree and character of competition in these markets which are categorized by the number of transistors the nature of product or elements the freedom of movement of firms and buyers and the suppliers, kind of available market information that is useful etc. The economists given theory of entity and industry considered as profit maximizing method, and accordingly suggests the marginal principle used as the optimum decision rule, erratic of differences between the markets. It is considered help of this principle that equilibrium price and exp ected output are determined at the firms optimum. At the market optimum level, the price costs and expected output are determined by the exchange of supply and demand. Following linear relations, a perfect competitive market model can be constituted. The operation of free market methods and mechanism as well as imperfections in the market used to be, regulated and operated by governmental influence such as taxes, subsides, minimum wage policy, price controls etc. The theoretical-demography and explanations in terms of such subjugate adjustments and interference does not always provide an idea 0 of there or no complexity of real international markets. For example, oligopolistic firms normally tend to maximize on sale by following [MR=O] principle considered as the main one. The complex price-output decisions that are made under the competition .not always be terminated in terms of economic theory and practices. The market forces shape organizational responses: Although there is a variety of market forces exists which may need to be addressed by any organization, there are three common factors that affect businesses in todays world: customer participation, information availability, information demand and cost pressure. These three are the important issues. According to Richard y. Chang (2005)Today, in many organizations who are keen to collect the payments for the purchase of products or services that is provided from the business but when it comes to returning those products or refunding those services, they call it a challenge to find a refund-sometimes requiring acute submissions of paperwork loading on them, long delays to receive a check from the customer by mail or confining the return/refund from the period to a short time framework that is useful to them.. How do these steps and policies can affect the prospect or influence of getting repeat business from these customers as soon as possible? Clearly, taking the lead decision onto en sure that the organization is completely prepared to search the key market vital forces impacting on the organizational performance made today and in the future will make strong Making the position as a strategic business leader in the business world it will lead the business. Business and cultural environment shape the behavior of the organization: Next to efficient structures and processes necessary to the organization, it is must to focus also on what people think normally, but to feel and do in and into the organizations so soon as possible. Keith (2011) and Newstrom (2012) illustrated that Managers should care in that way how the behavior of organizational employees evolves and adapts the rules, how employee behavior is completely shaped by group dynamics and social interaction possible way of change. Numerous results have influenced on managers when making a decision for the company regarding several issues. In theÂÂ  backgroundof any history one of the most significant change one is the procedures how employees used to behave and act in acompany. The organizational culture is absolute term for description the set of beliefs, norms, customs and values that represents fully the characteristics of an organization, and provides the extent for behavior within it individually. Conclusion: Optimal operation can be affected by an organizational culture which is shaped, leadership and management style that mirror environmental and cultural changes in the organization, as well as employee motivation useful for the better production. In such a culture innovations requires new employee behaviors customized the new research that is indispensible and different in order for the innovation to take root level of the company. It is a term used for analyzing scrutinizing the complex organization structure, with the emphasis which revolves around the improvement of shared assumptions made by it.A meaning, beliefs and values derived from the core, which shape and are reformed by employees behavior at working placeTo maximize organizational performance which is fully dependent on the higher satisfaction that requires an organizational culture which inspires employees to learn doing it together, grow and give their very best to the company.

Encoding RIP from Elaeis Guaneensis Jacq

Encoding RIP from Elaeis Guaneensis Jacq Detection and expression profiling of two novel transcripts encoding RIP from Elaeis guaneensis Jacq. in Ganoderma boninense interaction 1. Introduction Among several oil-producing plants, oil palm (Elaeis guineensis) is a tropical crop which is exclusively grown for oil production. Its high oil yield is extracted from oil palm’s thick fleshy mesocarp which is extremely rich in oil (80% of dry mass). Furthermore, oil palm has the highest oil production (oil per unit land) compared to other oil-producing plants. The extracted oil has been used widely for several applications including, food, cosmetics, and bio-fuel (Paterson 2007; Murphy 2009; Alizadeh et al. 2013). Among various diseases , the basal stem rot (BSR) is known to be the most serious disease in oil palm (Ho and Nawawi 1985). Furthermore, the BSR is caused by Ganoderma boninense which is considered specifically as a â€Å"white rot fungus†. The lignin is broken by the fungus leaving whitish cellulose exposed (Paterson 2007). The infection process is initiated when the oil palm roots are penetrated by fungal mycelia, which is spread out to the stem bole, after which the trunk eventually collapses (Rees et al. 2009). Malaysia and Indonesia have suffered the most severe losses from the BSR; furthermore, the diseases has been identified in Malaysia several decades ago (Ho and Nawawi 1985; Idris et al. 2004; Rees et al. 2007). Oil palms of different genetic origins have shown to have resistance to BSR. However, the genes involved in the resistance of oil palms against G. Boninense were unknown (Idris et al. 2004; Durand-Gasselin et al. 2005). Recently, few defence related genes were identified in oil palm. The major pathogen on oil palm in Malaysia has been identified as G. boninense Pat. Stem rots of oil palm caused by species of Ganoderma are a major threat to the sustainability of the oil palm production. In this study, we have isolated one cDNA encoding RIP’s EST, from oil palm. Its expression in oil palm root infected by G. boninese; was investigated to shed light on its potential involvement during early disease development. 2. Materials and methods 2.1 Sample preparation A total of 24 six-month-old oil palm seedlings (Elaeis guineensis Jacq., DxP, GH500 series) were purchased from Sime Darby Plantation Sdn. Bhd. (Banting Malaysia) and divided into two groups with 12 seedlings in each group, one of these groups were treated with Ganoderma boninense Pat. Strain PER71, while the remaining group served as controls. Seedlings treated with G.boninense were inoculated by sitting each seedling on rubber woodblock fully grown with G.boninense PER71 while the other group of seedlings were inoculated with fungal surface mulch as described by (Alizadeh et al., 2011). Three biological replicates of the seedlings were harvested from each treatment at 4, 8, 12 wpi, respectively. The leaves, roots and stem cell were frozen in liquid nitrogen and stored at -80 °C (Tan et al., 2013). 2.2 RNA extraction Total RNA was extracted from treated and untreated oil palm root tissues using a modified CTAB method briefly, 0.1 g tissue was ground in liquid nitrogen into a very find powder. The powder was immediately transferred into 1.5 ml extraction CTAB buffer [ 2% (w/v) cetyl trimethyl ammonium bromide, CTAB; 100mM Tris-HCl, pH 8.0; 2M NaCl; 25 mM ethylenediamineteraacetic acid, EDTA; pH 8.0; 2% (w/v) polyvinylpyrrolidone, PVP; and 2% (v/v) ÃŽ ²-mercaptoethanool]. Equal volume of chloroform/isoamylalcohol (24:1, v/v) was added into the tube and centrifuged at 12,857 g for 15 min at 4 °C. The upper layer was transferred into a new tube and equal volume of phenol/chloroform/isoamylalcohol (25:24:1, v/v/v) was added and centrifuged. This step was repeated until a clear supernatant was obtained. The supernatant was adjusted to a final concentration of 2M LiCl, and incubated at 4 °C for overnight, and then centrifuged. The RNA was dissolved in 5ml diethypyrocarbonate (DEPC) – treated water. An equal volume of chloroform/isoamylalcohol was added, mixed, and centrifuged at 12,857 for 30 min at 4 °C. Precipitation of RNA was performed by adding 0.1 vol of 3M sodium acetate (pH 5.2), 2 vol 100% ethanol and incubated at -80 °C for overnight. After centrifugation, the pellet was washed using 70% ethanol and dissolved in 20ul DEPC-treated water. The quality of RNA was examined by using a Nanodrop( BioRad) at 230, 260 and 280 nm. The RNA integrity was examined using 1.5% agarose gel electrophoresis. The RNA was treated with DNase I (Qiagen, USA) following the manufacturer’s instructions. Figure : Total RNA from various treated and untreated oil palm tissues. Lane A: Untreated control seedling. Lane B: Treated seedlings. 1) Leaf. 2) Basal stem. 3) Root 3. Semi-quantitative Reverse transcriptase (RT-) PCR 3.1 Isolation of cDNA Omniscript â„ ¢ Reverse Transcriptase kit (Qiagen Kit) was used for cDNA synthesis by the following kit manuscript. To obtain the sequence of cDNA from oil palm, gene specific primers were designed based on oil palm expressed sequence tag (EST) (Ho, 2010) and RIP’s type I alignments, using primer 3 version 0.4.0(frodo.wi.mit.edu). 3.2 Sequence analysis of cDNA Semi-quantitative Reverse transcriptase (RT-) PCR was performed on EST using PCR machine with Reverse transcriptase enzyme. Equal amounts of RNA (1ug) extracted from control and treated oil palm root samples were converted into cDNA by using the Omniscript two step Reverse Transcription Kit for cDNA Synthesis (Qiagen, USA) following the manufacturer’s instructions. The resulted sequences shown significant similarities to RIP (Naher et al., 2011). 3.3 Expression profiling Expression levels were calculated by Quantity One 1-D Analysis software 4.6.5 (Bio-Rad) according to the manufacturer’s instructions. PCR products were resolved on 1.5%(w/v) agarose gel (1xTAE) with a DNA mass standard marker (MassRuler TM DNA Ladder, Fermentas). The density of the DNA mass standard dilution series was used to generate calibration curve for absolute quantisation of sample bands by linear regression with extrapolation to zero for each experiment. The density of each sample band was then converted to an absolute quantity using the calibration curve. For each sample band was then converted to an absolute quantity using the calibration curve. For each experiment, the relative band quantity obtained by densitometrric analysis was normalized to the value of the internal control (house-keeping gene) bands which were run in parallel. Identification of differentially expressed genes was based on consistent ford-change across experimental replicates relative to untreate d negative control. Fold changes of ≠¥2- fold or ≠¤0.5-fold were considered as significant. 3.4 Statistical analysis A one-way analysis of variance (ANOVA) was used to determine statistical differences (SPSS version 17;SPSS Inc., Chicago, IL). When the ANOVA was significant at P 0.05 the Duncan’s multiple range test was used for means comparison. The t-test was used to compare between group means.(Alizadeh et al., 2011) 4. Results 4.1 sequence analysis EgRIP-1b The partial cDNA of EgRIP-1b (Dr. Ho personal comment) encodes a putative type I ribosome inactivating protein. The partial sequence consists 167 nucleotide residues. (Fig. 2). This sequence has the highest identity with RIP type I from Populus trichocarpa (98%, XP_002328056.1), Hordeum vulgare (90%, AAA32951.1) and Chain A, Structure Of Mutant Rip From Barley Seeds (90%, 4FBA_A). The NODE_77734GT was classified in a RIP-like superfamily. A putative conserved domain of catalytic residues and some RIP family domain were in this sequence, including that it is a member of the RIP superfamily.(Fig. 5) (Naher et al., 2011) M I C E S I R F E R I S E F L A T E F P G S S K P P K TGATGATCTGCGAGTCGATTAGATTCGAACGCATCTCCGAATTTCTTGCTACCGAATTCCCCGGCAGTTCGAAACCCCCTAAA W M P A L E H G W G D L S A A L L R A D A N P D R P F TGGATGCCGGCACTCGAGCACGGCTGGGGAGATCTCTTTGCCGCGTTGCTGCGCGCCGATGCCAATCCCGACCGTCCCTTCA Fig. 2. The nucleotide and deduced amino acid sequences of NODE_77734GT. 4.2 sequence analysis EgRIP-1a The partial cDNA sequence EgRIP-1a (GenBank ID: ) encodes a protein of 17 amino acid. The sequence consists 178 nucleotides (Fig. 3). This sequences has the highest identity with other type I RIPs from Nicotiana tabacum (47%, ABY71831.1), Musa acuminate (47%, ABY71832.1), Alocasia macrorrhizos (47%, ABY71829.1), Agave sisalana (47%, ABY71828.1) (Fig. 6.a) and (Fig. 6.b) M R P T P N F H Y E W S A CAGGATTCCAGCCGAGCTCCTGCGATAGCCGAACTTCTACCACATGCGACCTACTCCAAACTTCCACTACGAGTGGTCTGCTC L S K Q TCTCCAAACAA Fig. 3. The nucleotide and deduced amino acid sequences of EgRIP-1a. Fig. 4: multiple alignment of NODE with other type I RIPs. Amino acid residues that are identical in all sequences are highlighted in black while amino acid residues that are highly conserved are highlighted in gray; dashes represent gaps introduced to maximize the alignment. (a) (b) Fig. 5: Multiple alignment of EgRIP-1a with other RIPs. The protein sequences and their accession numbers used for analysis of detected sequence. a) Nucleotide residues that are highly conserved are highlighted in gray; dashes represent gaps introduced to maximize the alignment. b) Amino acid residues that are identical in all sequences are highlighted in black with amino acid residues that are highly conserved are highlighted in gray; dashes represent gaps introduced to maximize the alignment. 4.3 Expression profiles (of RIP) in oil palm root upon Ganoderma inoculation A total of 2 cDNA sequences encoding putative defence-related proteins from oil palm were chosen for gene expression profiling in this study. A relative semi-quantification of EgRIP-1b and EgRIP-1b transcripts were performed by calibrating the expression of each gene with an endogenous control, actin. Fig.6 Shows the relative expression level of EgRIP-1b in roots and basal stems in response to the inoculation of G. boninense at different time points compared with that of negative control plants. In G. boninense-treated plants, the gene expression of EgRIP-1b in oil palm roots at 2 wpi was induced. The expression level were n- and n-fold of the uninfected root tissues at 8 and 12 wpi, respectively.(Naher et al., 2011) The expression level was studied in 3 replication of each sample, there were no significant (P>0.05) differences in expression levels in inoculated plants (Alizadeh et al., 2011). EgRIP-1a was up-regulated n-fold and n-fold at X wpi, respectively; before the transcript level decrease at Y wpi in oil palm root tissue following G.boninense infection (Fig). EgRIP-1a expression level were m-, m- and m-fold of the uninfected basal stem tissues at 2,4, 8 and 12 wpi, respectively. EgRIP-1b and EgRIP-1a were not expressed in time zero, untreated samples and leaf tissues. (I) diseased (II) healthy (a) (b) (c) Fig. 6. Differential expression of EgRIP-1b in variety tissues in response to I) G.boninese treatment compare to those in II )control.. a) root tissue, b) stem cell tissue, c) standard (Rippmann et al., 1997) a) b) Fig. 7. Expression level mean in each biological replicate a) in root; b) in stem (I) diseased (II) healthy (a) (b) (c) Fig. 8. Differential expression of EgRIP-1a in variety tissues in response to I) G.boninese treatment compare to those in II) control.. a) root tissue, b) stem cell tissue, c) leaf tissue d)control (Rippmann et al., 1997) a) b) Fig. 9. Expression level mean in each biological replicate a) in root; b) in stem Fig. 10. Semi-quantification of oil palm EgRIP-1a and EgRIP-1b expression levels in root tissues at 2-12 week after inoculation with G.boninense. Significant up-regulation of gene expression compared to untreated negative control. References Alizadeh F, Abdullah SNA, Chong PP, Selamat A Bin (2013) Expression Analysis of Fatty Acid Biosynthetic Pathway Genes during Interactions of Oil Palm (Elaeis guineensis Jacq.) with the Pathogenic Ganoderma boninense and Symbiotic Trichoderma harzianum Fungal Organisms. Plant Molecular Biology Reporter. doi: 10.1007/s11105-013-0595-y Durand-Gasselin T, Asmady H, Flori a, et al. (2005) Possible sources of genetic resistance in oil palm (Elaeis guineensis Jacq.) to basal stem rot caused by Ganoderma boninenseprospects for future breeding. Mycopathologia 159:93–100. doi: 10.1007/s11046-004-4429-1 Ho YW, Nawawi A (1985) Ganoderma boninense Pat . from Basal Stem Rot of Oil Palm ( Elaeis guineensis ) in Peninsular Malaysia. Pertanika 8:425–428. Idris AS, Kushairi A, Ismail S, Ariffin D (2004) SELECTION FOR PARTIAL RESISTANCE IN OIL PALM PROGENIES TO Ganoderma BASAL STEM ROT. Journal of Oil Palm Research 16:12–18. Murphy DJ (2009) Oil palm: future prospects for yield and quality improvements. Lipid Technology 21:257–260. doi: 10.1002/lite.200900067 Paterson R (2007) Ganoderma disease of oil palm—A white rot perspective necessary for integrated control. Crop Protection. doi: 10.1016/j.cropro.2006.11.009 pilotti CA (2005) Stem rots of oil palm caused by Ganoderma boninense: Pathogen biology and epidemiology. Mycopathologia 159:129–137. Rees RW, Flood J, Hasan Y, et al. (2009) Basal stem rot of oil palm ( Elaeis guineensis ); mode of root infection and lower stem invasion by Ganoderma boninense. Plant Pathology 58:982–989. doi: 10.1111/j.1365-3059.2009.02100.x Rees RW, Flood J, Hasan Y, Cooper RM (2007) Effects of inoculum potential, shading and soil temperature on root infection of oil palm seedlings by the basal stem rot pathogen Ganoderma boninense. Plant Pathology. doi: 10.1111/j.1365-3059.2007.01621.x Tan Y-C, Yeoh K-A, Wong M-Y, Ho C-L (2013) Expression profiles of putative defence-related proteins in oil palm (Elaeis guineensis) colonized by Ganoderma boninense. Journal of plant physiology. doi: 10.1016/j.jplph.2013.05.009